Critical Review: Bioremediation of Polycyclic Aromatic Hydrocarbons from Industry Contaminated Soil Using Indegenous Bacillus spp.

 Alonzo Bell

Critical Review

Article: Bioremediation of Polycyclic Aromatic Hydrocarbons from Industry Contaminated Soil Using Indegenous Bacillus spp. 

Authors: Prisha Mandree, Wendy Masika, Justin Naiker, Ghaneshree Moonsamy, Santosh Ramchuran and Rajesh Lalloo

Journal: Processes

1. Comments to Authors

A major contribution of this paper is that it provides context about the specific polycyclic aromatic hydrocarbons and organisms which are capable of remediating these compounds in Johannesburg, South Africa. The authors go into detail about 6 particular Bacillus strains and their ability to break down heavy weight molecular hydrocarbons. A strength of this paper is that the authors focus on using organisms which can oxidize and break down large carbon molecules such as ; naphthalene, athraprene, phenanthrene and pyrene. By focusing on these largely insoluble substances, this study can help influence future bioremediation efforts in areas of concern in South Africa. Another strength of this research is that it focuses on the degradation of low and high molecular weight hydrocarbons, which currently pollute waterways in Africa. The study also provides a strong basis of research because they used soil samples from 38 sites, which gives them sufficient information on the PAH contents in these petroleum and oil polluted soils. This study demonstrates the efficiency of bioaugmentation using bacillus consortiums and the addition of nutrients to facilitate the degradation of these volatile chemicals. Another major contribution is that methods used to obtain results are detailed, organized and provide sufficient information on how conclusions were reached in this study. 

2. General

This study is important in the field of microbiology because it helps strengthen case studies regarding bioremediation with known capable bacteria and fungi. This article would be interesting for readers who are interested in learning about bioremediation of large volatile hydrocarbons in African environments. The authors iterated the point that various soils across South Africa have polycyclic aromatic hydrocarbons which exceed permissible limits. The authors highlight the benefits which these experiments can bring to these ecosystems. The science in this article is sound and backed by specific data, graphs, illustrations and equations. The organization of the article is detailed and clear on the objectives which it is trying to prove. The argument is cohesive and consistent throughout the article. The experiment examines the capabilities of 6 of the most present strains of bacillus and incubates them for up to 48 hours and tests two prototypes to convey the efficiency of the bacteria in degrading large hydrocarbon substances. This can be an important breakthrough for bioremediation in Johannesburg, South Africa. Conclusions are clearly supported by data, graphs, figures and equations. The data and conclusions supplement each other and solidify the study. The length of this study is relative to the number of ideas and information because it provides a lot of background and context on this particular subject of PAH degradation in relation to their experiment. The writing style was concise and consistent throughout the article.  

3. Specific

1. Presentation

This article tells a cohesive story in explaining the significance in the role which Bacillus and other microorganisms play in the breaking down of large carbon ring fused molecules. The authors assess the diversity of microorganisms and also list many organisms which are frequently used in bioremediation. The authors utilizes two prototypes to assess the efficiency of degradation of PAHs by Bacillus strains. The argument is backed with evidence in showing that prototype 2 can be efficient, and it is reported throughout the article supporting the argument of  bacillus being able to effectively remove large PAHs from contaminated soil samples.  

2. Length 

The length of the paper was appropriate based on the amount of data and text needed to explain the main points of this study. I think condensing the methods section can make it easier for the reader to follow and understand the complex processes. 

3. Methods

Methods are appropriate and described thoroughly so that someone can repeat the process. Primers were used to identify successful isolates which degrade hydrocarbons ; and those are 27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACT. Using this sequence authors were able to select strains. Strains which were proven to be most efficient in degradation of large hydrocarbons were selected to be used in the bioaugmentation process of prototype 2. 

4. Data Representation 

As results are stated, I can easily verify them through the text, graphs, data, illustration and figures. The study shows that prototype 2 has removed naphthalene, phenanthrene, pyrene and flurothane at a rate of 100%, and it is correlated to figure 5 which contributes to the argument. All figures and tables are labeled correctly and correlated to significant objectives of this study. The data representation is complex but it's necessary to provide a scope of degradation of polycyclic aromatic hydrocarbons by 6 bacillus strains. 

5. Statistical Design and Analysis

The statistical design and analysis is represented throughout the article by correlating each of its major points with a table, graph, equation or figure to solidify the efficiency of degradation of large hydrocarbon molecules. Measurements can be observed under the methods and the conclusion section. Significant statements are justified in the text, figure 3, figure 4 and figure 5. These figures support the argument that hydrocarbon degradation by bacillus can be an efficient and viable process in Johannesburg, South Africa. 

6. Errors

I didn’t notice any errors in technique, style, fact, calculation or interpretation. 

7. Citations 

All pertinent references are cited and also alphabetized. 

8. Overlap

The originality in this article is that it examines substances in Johannesburg, South Africa such as; fluoranthene and pyrene which aren’t as frequently studied as other polycyclic aromatic hydrocarbons and aromatics. The paper does not report data or conclusions which have been published yet.